cancel
Showing results for 
Search instead for 
Did you mean: 

peggyw
Node
since ‎03-25-2020
‎06-01-2022

User Statistics

  • 2 Posts
  • 0 Solutions
  • 0 Kudos given
  • 0 Kudos received

User Activity

I have a sequence string 'TTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCT' I have nodes with the label Sequence and property seqFull which contains a large DNA String. Want to return the nodes and the similarity score where the...